Marker name | TGS1588 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GTGCTGCTAAACACAACTGGTTC | |
Rv | AATCATCAATGGCTTCCACC | ||
EST/Genome sequences | LE_HBa0217O02_SP6_393803 | ||
Map | AMF2 | Linkage | ch01 |
Position | 1.66 | ||
SSR | Fragment size | 154 | |
Pattern* | AAG(mis1) | ||
Repeat count | 9 | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.