Marker name | TGS1476 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GTCATGGGAATGACACTAACGAG | |
Rv | AGTGTGTGTGTTTGTGTGCG | ||
EST/Genome sequences | LE_HBa0167P05_T7_13401 | ||
Map | Expen2000 | Linkage | ch11 |
Position | 80.134 | ||
AMF2 | Linkage | ch11 | |
Position | 57.14 | ||
SSR | Fragment size | 222 | |
Pattern* | AC(mis1) | ||
Repeat count | 29 | ||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.