Marker name | TGS1365 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GCATGAATGGGTGGTTCATCA | |
Rv | ACCCCTAGCTAGCTCCAACC | ||
EST/Genome sequences | SL_MboI0024E13_T7_150581 | ||
Map | Expen2000 | Linkage | ch09 |
Position | 59.517 | ||
SSR | Fragment size | 206 | |
Pattern* | AAAT | ||
Repeat count | 5 | ||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.