Marker name | TGS1129 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GTGTTTTTGTCTCTGCTCGGA | |
Rv | ATGATCATTGCATTTGCTGC | ||
EST/Genome sequences | LE_HBa0217G23_SP6_393134 | ||
Map | AMF2 | Linkage | ch05 |
Position | 42.576 | ||
SSR | Fragment size | 234 | |
Pattern* | AG | ||
Repeat count | 12 | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.