Marker name | TGS1009 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GAATCATCACCAAACATCCCC | |
Rv | TGAAATGGGAAAAGTGTTTGC | ||
EST/Genome sequences | SL_MboI0104M02_T7_198328 | ||
Map | AMF2 | Linkage | ch01 |
Position | 5.253 | ||
SSR | Fragment size | 160 | |
Pattern* | AAT | ||
Repeat count | 8 | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.