Marker name | TGS0868 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | CCTGGGCAGATATTTCAGGA | |
Rv | GCTAAAGGCAAGCGAATGAC | ||
EST/Genome sequences | SL_MboI0046N18_T7_224574 | ||
Map | Expen2000 | Linkage | ch08 |
Position | 22.493 | ||
SSR | Fragment size | 205 | |
Pattern* | AT | ||
Repeat count | 13 | ||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.