| Marker name | TGS0719 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | GTCTTGTTTACGCCACCTCCT | |
| Rv | AGGCCTCGTGAGGTCTCTTA | ||
| EST/Genome sequences | SL_MboI0063K01_T7_179796 | ||
| Map | AMF2 | Linkage | ch11 |
| Position | 59.726 | ||
| SSR | Fragment size | 190 | |
| Pattern* | AG | ||
| Repeat count | 14 | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.