Marker name | TGS0591 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GCGCTGTAGAAAGAGCTTGGG | |
Rv | TGTAATTTGGCATCACGCAT | ||
EST/Genome sequences | LE_HBa0163B14_SP6_262015 | ||
Map | Expen2000 | Linkage | ch12 |
Position | 118.396 | ||
AMF2 | Linkage | ch12 | |
Position | 134.701 | ||
SSR | Fragment size | 275 | |
Pattern* | AT | ||
Repeat count | 16 | ||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.