Tomato Marker Database

TGS0563 Information

Marker name TGS0563
Marker category Genome-SSR
Primer sequences Fw GAGATTCACCAAATGGCAAGA
Rv CGTTTTAAGGGTTCGGGATT
EST/Genome sequences LE_HBa0135F16_SP6_61326
Map AMF2 Linkage ch11
Position 116.102
SSR Fragment size 208
Pattern* AT
Repeat count 16
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum