| Marker name | TGS0411 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | GAATGATTCATCCCCAATCCA | |
| Rv | TGTCAAATGACAGCACAAAAGA | ||
| EST/Genome sequences | SL_EcoRI0009B23_T7_226629 | ||
| Map | Expen2000 | Linkage | ch04 |
| Position | 18.275 | ||
| AMF2 | Linkage | ch04 | |
| Position | 37.643 | ||
| SSR | Fragment size | 242 | |
| Pattern* | AT | ||
| Repeat count | 19 | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.