| Marker name | TGS0410 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | GAAATGGCTTCAGACAATGAAA | |
| Rv | TTCCTCTGGTTGGGTAGAGC | ||
| EST/Genome sequences | LE_HBa0107D05_SP6_266974 | ||
| Map | Expen2000 | Linkage | ch11 |
| Position | 66.85 | ||
| AMF2 | Linkage | ch11 | |
| Position | 60.29 | ||
| SSR | Fragment size | 299 | |
| Pattern* | AT | ||
| Repeat count | 19 | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.