Marker name | TGS0241 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GTTTGATACACGTAGGCGCAC | |
Rv | TGCATAAGCACAAGTATCATTGG | ||
EST/Genome sequences | SL_EcoRI0065M20_SP6_258024 | ||
Map | AMF2 | Linkage | ch01 |
Position | 52.36 | ||
SSR | Fragment size | 153 | |
Pattern* | AT | ||
Repeat count | 24 | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.