Tomato Marker Database

TES7394 Information

Marker name TES7394
Marker category EST-SSR
Primer sequences Fw gagattcgggtgcattgtgat
Rv ttctttcttgtcaccgcctt
EST/Genome sequences LEFL2007C11
SSR Fragment size 290
Pattern* GGC(mis2)
Repeat count 5
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum