Tomato Marker Database

TES4308 Information

Marker name TES4308
Marker category EST-SSR
Primer sequences Fw ggagtcgtccactcagcttc
Rv tcagcaactctctcagtcttgg
EST/Genome sequences LEFL2039C13
SSR Fragment size 203
Pattern* AAGC(mis2)
Repeat count 4
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum