Tomato Marker Database

TES4293 Information

Marker name TES4293
Marker category EST-SSR
Primer sequences Fw gtggcatgagaccaaacacac
Rv agtcgaaaaacctcgcttga
EST/Genome sequences LEFL2029L14
SSR Fragment size 241
Pattern* AAAG(mis2)
Repeat count 4
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum