Tomato Marker Database

TES4145 Information

Marker name TES4145
Marker category EST-SSR
Primer sequences Fw ccccctgtttaagcaacaga
Rv gcacctggggttcattagaa
EST/Genome sequences LEFL1007DA07
SSR Fragment size 292
Pattern* AC(mis2)
Repeat count 8
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum