Tomato Marker Database

TES3353 Information

Marker name TES3353
Marker category EST-SSR
Primer sequences Fw tcagcttcaacaaatccgttt
Rv gaaattcgagctcggagaaa
EST/Genome sequences LEFL2019L09
SSR Fragment size 167
Pattern* AAG(mis2)
Repeat count 6
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum