Tomato Marker Database

TES2180 Information

Marker name TES2180
Marker category EST-SSR
Primer sequences Fw ggaacactcaacactgttcacttc
Rv ccaatcaaatgcccttgaac
EST/Genome sequences LEFL1062BF09
SSR Fragment size 220
Pattern* AC(mis2)
Repeat count 11
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum