Tomato Marker Database

TES2033 Information

Marker name TES2033
Marker category EST-SSR
Primer sequences Fw gtgacatatgtgtgccccaat
Rv acaaattgaggaatggtggg
EST/Genome sequences LEFL2009O20
Map Expen2000 Linkage ch04
Position 59.837
SSR Fragment size 280
Pattern* AAC(mis1)
Repeat count 5
Comments
KDRI

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum