| Marker name | TES1745 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | gttgaattgaaactttggccc | |
| Rv | cgcagagaatggtaatgatcaaa | ||
| EST/Genome sequences | LEFL2055J22 | ||
| Map | AMF2 | Linkage | ch11 |
| Position | 29.455 | ||
| SSR | Fragment size | 167 | |
| Pattern* | AAT(mis1) | ||
| Repeat count | 6 | ||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.