Tomato Marker Database

TES1732 Information

Marker name TES1732
Marker category EST-SSR
Primer sequences Fw gatccctccggttaactccaa
Rv tgggtttttcagctgttcc
EST/Genome sequences LEFL2037E24
SSR Fragment size 262
Pattern* ATC(mis1)
Repeat count 6
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum