| Marker name | TES1719 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | ggcgaatcatcgttgttctt | |
| Rv | caaaaggatccgatcgaaaa | ||
| EST/Genome sequences | LEFL2011J19 | ||
| Map | Expen2000 | Linkage | ch08 |
| Position | 59.512 | ||
| SSR | Fragment size | 94 | |
| Pattern* | ATC(mis1) | ||
| Repeat count | 6 | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.