Tomato Marker Database

TES1709 Information

Marker name TES1709
Marker category EST-SSR
Primer sequences Fw gcatcctcttcatcctcgtc
Rv agctggagggtcattttcgta
EST/Genome sequences LEFL1091BH12
Map Expen2000 Linkage ch04
Position 57.361
SSR Fragment size 188
Pattern* AAG(mis1)
Repeat count 6
Comments
KDRI

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum