Tomato Marker Database

TES1683 Information

Marker name TES1683
Marker category EST-SSR
Primer sequences Fw tccctttttatttcctattcatca
Rv gatgaacgctttaatcggga
EST/Genome sequences LEFL1044CD07
Map Expen2000 Linkage ch01
Position 128.973
SSR Fragment size 252
Pattern* AAG(mis1)
Repeat count 6
Comments
KDRI

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum