Tomato Marker Database

TES1677 Information

Marker name TES1677
Marker category EST-SSR
Primer sequences Fw catttcaataaaaccctttccc
Rv gtacgatccaattgccgagt
EST/Genome sequences LEFL1037BA05
Map Expen2000 Linkage ch12
Position 59.547
SSR Fragment size 201
Pattern* AG(mis1)
Repeat count 9
Comments
KDRI

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum