Tomato Marker Database

TES1266 Information

Marker name TES1266
Marker category EST-SSR
Primer sequences Fw gttttggtgtcaccttcctcc
Rv ccagcttccttgatagcagc
EST/Genome sequences LEFL2030K07
Map Expen2000 Linkage ch10
Position 33.903
SSR Fragment size 241
Pattern* AT(mis1)
Repeat count 10
Comments
KDRI

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum