Tomato Marker Database

TES1259 Information

Marker name TES1259
Marker category EST-SSR
Primer sequences Fw gtggtctttcgctcactgatg
Rv catttcacagactcccctcaa
EST/Genome sequences LEFL1072AB01
Map Expen2000 Linkage ch01
Position 36.43
SSR Fragment size 148
Pattern* AAAG(mis1)
Repeat count 5
Comments
KDRI

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum