Tomato Marker Database

TES0822 Information

Marker name TES0822
Marker category EST-SSR
Primer sequences Fw gtttggtactacgtttccgcc
Rv caacgcacaattcaaccatc
EST/Genome sequences FC15DB12
SSR Fragment size 157
Pattern* GGT(mis1)
Repeat count 8
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum