Tomato Marker Database

TES0577 Information

Marker name TES0577
Marker category EST-SSR
Primer sequences Fw GTTCAATTCTCTTCTCTCTCAGCTC
Rv TTTTGTGCGGAAAATCCAAT
EST/Genome sequences Singlet2124
SSR Fragment size 93
Pattern* AT(mis1)
Repeat count 18.5
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum