| Marker name | TES0489 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | gaactgctgctgtggcttttt | |
| Rv | taaatcccacggagaggatg | ||
| EST/Genome sequences | LEFL1057AA06 | ||
| Map | Expen2000 | Linkage | ch01 |
| Position | 36.644 | ||
| SSR | Fragment size | 248 | |
| Pattern* | AAGC | ||
| Repeat count | 5 | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.