Tomato Marker Database

TES0327 Information

Marker name TES0327
Marker category EST-SSR
Primer sequences Fw tgtatgggcagagagagaaaga
Rv gcccgttattctgaactgga
EST/Genome sequences LEFL1067BA02
SSR Fragment size 243
Pattern* AG
Repeat count 11
Comments
KDRI

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum