Marker name | TES0315 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | AATTGCAGCCTTTGGGTAAA | |
Rv | GCCTTTATTTTCATTTGAGCTATGA | ||
EST/Genome sequences | Contig11095 | ||
Map | AMF2 | Linkage | ch02 |
Position | 22.506 | ||
SSR | Fragment size | 199 | |
Pattern* | AT | ||
Repeat count | 11 | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.