Tomato Marker Database

TES0293 Information

Marker name TES0293
Marker category EST-SSR
Primer sequences Fw gccgcccatagcatagacca
Rv aatcccaagtaaacccaccc
EST/Genome sequences LEFL2001AF12
Map Expen2000 Linkage ch03
Position 60.317
SSR Fragment size 249
Pattern* AAC
Repeat count 8
Comments
KDRI

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum