Tomato Marker Database

TES0141 Information

Marker name TES0141
Marker category EST-SSR
Primer sequences Fw gatggccgtttctctcacagt
Rv tgggtattttgggtttgttg
EST/Genome sequences LEFL1070AC12
Map AMF2 Linkage ch09
Position 1.374
SSR Fragment size 94
Pattern* ATC
Repeat count 9
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum