Marker name | TES0082 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | GCGAGAAGCTAGCATGCCATA | |
Rv | TTGACGATCATCTACCCATGA | ||
EST/Genome sequences | Contig12917 | ||
Map | AMF2 | Linkage | ch07 |
Position | 97.619 | ||
SSR | Fragment size | 259 | |
Pattern* | AT | ||
Repeat count | 14 | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.