Marker name | TES0019 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | GTCCCCCATTTCAATTTTCTG | |
Rv | TTGTAGAGGACCCAAATCGG | ||
EST/Genome sequences | Contig11234 | ||
Map | AMF2 | Linkage | ch07 |
Position | 51.937 | ||
SSR | Fragment size | 240 | |
Pattern* | ACT | ||
Repeat count | 13 | ||
Comments | NIVTS Ohyama et al. 2009 http://vegmarks.nivot.affrc.go.jp/ |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.