Marker name | TEI0815 | ||
---|---|---|---|
Marker category | Intron-SNP | ||
Primer sequences | Fw | CAAACGTTCAAGGTTCTAAAGGA | |
Rv | CCCCTGATATCCCAGAACAA | ||
EST/Genome sequences | Contig19754_1136_1137 | ||
Map | Expen2000 | Linkage | ch12 |
Position | 58.407 | ||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.