Sub clover Marker Database

original sequence
>Tsud_sc01389.00_54664 SNP sequence
TAAGCAACTAAATGTTTTGAACCGTCCTATTAAAA[C/T]CAAACTATCTAAATGTTAAA
CTTTAACCAGTCCAA


MarkerDB | Trifolium subterraneum