Sub clover Marker Database

original sequence
>Tsud_sc01084.00_11034 SNP sequence
ATTTCCATTTAATCCTCCATTAGTGGTACCAATCG[C/T]CGAAATCCCATTACCATCAA
CCTGTGCAGGGGCAC


MarkerDB | Trifolium subterraneum