Sub clover Marker Database

original sequence
>Tsud_sc01083.00_81230 SNP sequence
GCGTGGGGTTTTGGAGCTCTCGGCACAAGTAAATT[A/G]TGCTTGGTGTTCGGCGGAGG
TTGAATCGGAGACTC


MarkerDB | Trifolium subterraneum