Sub clover Marker Database

original sequence
>Tsud_sc00827.20_1988 SNP sequence
TGTGATGTCATGTTGAGGATGTCATAGATGATTCT[A/G]GTGTGAAATGTGTTAATGGA
CTTAATATGGAATGA


MarkerDB | Trifolium subterraneum