Sub clover Marker Database

original sequence
>Tsud_sc00770.00_89372 SNP sequence
CTTGAGCAAATCCCAAGTTGGAACAATGTCATTGC[A/G]TAAAACAGAAAACGAACTTT
GCAGAAAAGGAAGGG


MarkerDB | Trifolium subterraneum