Sub clover Marker Database

original sequence
>Tsud_sc00659.00_240099 SNP sequence
AATGTCAAGCGCTGCAAACATTTCCGAAATTTGTG[C/T]GAACAGCTAAGGCATGCATT
ATTAGTAGCACTGCT


MarkerDB | Trifolium subterraneum