Sub clover Marker Database

original sequence
>Tsud_sc00422.00_232270 SNP sequence
ACCATACAAACAATAGCATCACCTCCACCTTCAAT[C/T]ATCTCCACTCTCGTCACAAC
CACTGCTTCAATTTT


MarkerDB | Trifolium subterraneum