Sub clover Marker Database

original sequence
>Tsud_sc00307.20_168421 SNP sequence
CTTCAGTTTGGTAATGCTGCATTCCCTCTACAAAA[T/C]CTGTTGATGAGTGCTTCACA
CCAATCTCAACTACC


MarkerDB | Trifolium subterraneum