Sub clover Marker Database

original sequence
>Tsud_sc00295.00_477678 SNP sequence
AAAGATCAGCATCATGCGGTTTCCATCTTCTACGA[A/T]CATATGACGTCCGTAAAGGT
CTAACCTGTTCCAGC


MarkerDB | Trifolium subterraneum