Sub clover Marker Database

original sequence
>Tsud_sc00280.20_17329 SNP sequence
TGTGAGTCTGATGTATAAACAGATTGATGAGTCTC[C/T]GGGTAGCAAATCAAAGGCTG
TATAAACCACAATAT


MarkerDB | Trifolium subterraneum