Sub clover Marker Database

original sequence
>Tsud_sc00181.00_314996 SNP sequence
TAACATCTGTTGAAGATTTCTTCAATCCTCTAGAC[C/T]ATCATCTCTACTTTTAGTAA
AGATTGATCCTCTTC


MarkerDB | Trifolium subterraneum