Sub clover Marker Database

original sequence
>Tsud_sc00088.00_200860 SNP sequence
TGTGCATCAAAGTTGTTATTATTATGGATCGAACT[T/C]CTTGCATGAAAGAGTTCCCT
CAAAATTTGAGTTAG


MarkerDB | Trifolium subterraneum