Sub clover Marker Database

original sequence
>Tsud_sc00084.10_393705 SNP sequence
ATTGATTTCAAACTTTCTTGATATATCCTAATTCC[G/C]AAGGAGTTTATAAGAAGAGG
AGGTTTATCAATATG


MarkerDB | Trifolium subterraneum